ebna 1 Search Results


93
Miltenyi Biotec epstein barr nuclear antigen 1 ebna1
T cell responses towards the viral antigens <t>EBNA1</t> and BZLF1 and the superantigen SEB in cirrhosis. ( A ) Representative plots of intracellular cytokine staining for TNF-α and IFN-γ in T cells after stimulation with SEB. ( B ) Distribution and median of T cell responses after stimulation with SEB, EBNA1 and BZLF1 in controls (circles), cirrhotic patients without inflammation (diamonds) and cirrhotic patients with inflammation (triangles). A positive response was defined as a cytokine-positive cell frequency of at least 2-fold above background (no antigen control) and the responses for TNF-α in CD4 + and CD8 + cells and for IFN-γ in CD4 + and CD8 + cells were added to a total score of 0 to 4. ( C ) Median and distribution of reacting CD4 T cells (left) and CD8 T cells (right) after SEB stimulation in cirrhotic patients with and without inflammation (+/−infl). ** indicates P values <0.01 in Mann–Whitney U test. ( D ) Mean florescence intensity (MFI) and standard error of mean are indicated for the intensity of TNF-α or IFN-γ response in CD4 + and CD8 + T cells after stimulation with SEB. P-values indicate results in Kruskal-Wallis test for each cytokine and T cell subset and asterisks indicate significance level in post-hoc Dunn’s multiple comparison test (* P <0.05; ** p<0.01). ( E ) Serum IL-10 levels from cirrhotic patients with a null response according to the aforementioned criteria (0) and from cirrhotic patients with at least one cytokine response (+) after stimulation with EBNA1 and BZLF1 are indicated (available from 25 cirrhotic patients). Patients were either stratified for the presence of a null response to EBNA1 or BZLF1 (left; P value in Mann–Whitney U test is indicated) and stratified for the combination of null-responses towards EBNA1 and BZLF1 (right; Jonckheere-Terpstra test demonstrates an increase in IL-10 in patients across the groups).
Epstein Barr Nuclear Antigen 1 Ebna1, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/epstein barr nuclear antigen 1 ebna1/product/Miltenyi Biotec
Average 93 stars, based on 1 article reviews
epstein barr nuclear antigen 1 ebna1 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc pcxb ebna1
T cell responses towards the viral antigens <t>EBNA1</t> and BZLF1 and the superantigen SEB in cirrhosis. ( A ) Representative plots of intracellular cytokine staining for TNF-α and IFN-γ in T cells after stimulation with SEB. ( B ) Distribution and median of T cell responses after stimulation with SEB, EBNA1 and BZLF1 in controls (circles), cirrhotic patients without inflammation (diamonds) and cirrhotic patients with inflammation (triangles). A positive response was defined as a cytokine-positive cell frequency of at least 2-fold above background (no antigen control) and the responses for TNF-α in CD4 + and CD8 + cells and for IFN-γ in CD4 + and CD8 + cells were added to a total score of 0 to 4. ( C ) Median and distribution of reacting CD4 T cells (left) and CD8 T cells (right) after SEB stimulation in cirrhotic patients with and without inflammation (+/−infl). ** indicates P values <0.01 in Mann–Whitney U test. ( D ) Mean florescence intensity (MFI) and standard error of mean are indicated for the intensity of TNF-α or IFN-γ response in CD4 + and CD8 + T cells after stimulation with SEB. P-values indicate results in Kruskal-Wallis test for each cytokine and T cell subset and asterisks indicate significance level in post-hoc Dunn’s multiple comparison test (* P <0.05; ** p<0.01). ( E ) Serum IL-10 levels from cirrhotic patients with a null response according to the aforementioned criteria (0) and from cirrhotic patients with at least one cytokine response (+) after stimulation with EBNA1 and BZLF1 are indicated (available from 25 cirrhotic patients). Patients were either stratified for the presence of a null response to EBNA1 or BZLF1 (left; P value in Mann–Whitney U test is indicated) and stratified for the combination of null-responses towards EBNA1 and BZLF1 (right; Jonckheere-Terpstra test demonstrates an increase in IL-10 in patients across the groups).
Pcxb Ebna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcxb ebna1/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcxb ebna1 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

95
Santa Cruz Biotechnology anti ebv ebna1
A) Relative quantification of relative intracellular and extracellular EBV genome copy numbers. qPCR assay with <t>EBNA1</t> primer set (EBV 96778–96979, EBV 96827–96845) was conducted to measure EBV genome copy numbers in all four types of HEK293-EBV cells which were either uninduced or induced with TPA and NaB. B(-)Wt, B(-)Mt, B(+)Wt, and B(+)Mt stand for HEK293-EBV cells of BART(-)·S13 + , BART(-)·S13 - , BART(+)·S13 + , BART(+)·S13 - , respectively. Absolute intracellular and extracellular EBV genome copy numbers were Both absolute intracellular and extracellular EBV genome copy numbers were evaluated by EBNA1 Ct values. Relation equation between absolute DNA amounts and EBNA1 Ct values was first defined and then applied to calculate DNA concentration (μg/μL) per length of template (bp) using a website called Copy Number Calculator of Technology NetWorks ( https://www.technologynetworks.com/tn/tools/copynumbercalculator ). Finally, Both absolute intracellular and extracellular EBV genome copy numbers were calculated by relatively comparing EBV genome copy numbers of Mt BART(+/-)·S13 - EBVs with EBV genome copy numbers of Wt BART(+/-)·S13 + EBVs. B) Comparison of expression patterns of the selected five BART miRNAs between uninduced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. C) Comparison of expression patterns of the selected five BART miRNAs between induced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. 3 mM NaB and 20 μg/mL TPA were used to induce EBV lytic reactivation. D) Comparison of transcription patterns of EBV major genes between uninduced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. E) Comparison of transcription patterns of EBV major genes between induced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. F) Comparison of expression patterns of EBNA1 and BZLF1 proteins between BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells in uninduced or induced conditions. In panels, experiments were independently repeated two times, and data are represented as mean ± SD. Statistical analysis were performed using paired t test.
Anti Ebv Ebna1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti ebv ebna1/product/Santa Cruz Biotechnology
Average 95 stars, based on 1 article reviews
anti ebv ebna1 - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

95
Addgene inc pcxwbebna1
A) Relative quantification of relative intracellular and extracellular EBV genome copy numbers. qPCR assay with <t>EBNA1</t> primer set (EBV 96778–96979, EBV 96827–96845) was conducted to measure EBV genome copy numbers in all four types of HEK293-EBV cells which were either uninduced or induced with TPA and NaB. B(-)Wt, B(-)Mt, B(+)Wt, and B(+)Mt stand for HEK293-EBV cells of BART(-)·S13 + , BART(-)·S13 - , BART(+)·S13 + , BART(+)·S13 - , respectively. Absolute intracellular and extracellular EBV genome copy numbers were Both absolute intracellular and extracellular EBV genome copy numbers were evaluated by EBNA1 Ct values. Relation equation between absolute DNA amounts and EBNA1 Ct values was first defined and then applied to calculate DNA concentration (μg/μL) per length of template (bp) using a website called Copy Number Calculator of Technology NetWorks ( https://www.technologynetworks.com/tn/tools/copynumbercalculator ). Finally, Both absolute intracellular and extracellular EBV genome copy numbers were calculated by relatively comparing EBV genome copy numbers of Mt BART(+/-)·S13 - EBVs with EBV genome copy numbers of Wt BART(+/-)·S13 + EBVs. B) Comparison of expression patterns of the selected five BART miRNAs between uninduced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. C) Comparison of expression patterns of the selected five BART miRNAs between induced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. 3 mM NaB and 20 μg/mL TPA were used to induce EBV lytic reactivation. D) Comparison of transcription patterns of EBV major genes between uninduced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. E) Comparison of transcription patterns of EBV major genes between induced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. F) Comparison of expression patterns of EBNA1 and BZLF1 proteins between BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells in uninduced or induced conditions. In panels, experiments were independently repeated two times, and data are represented as mean ± SD. Statistical analysis were performed using paired t test.
Pcxwbebna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcxwbebna1/product/Addgene inc
Average 95 stars, based on 1 article reviews
pcxwbebna1 - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

90
Addgene inc plasmid id
A) Relative quantification of relative intracellular and extracellular EBV genome copy numbers. qPCR assay with <t>EBNA1</t> primer set (EBV 96778–96979, EBV 96827–96845) was conducted to measure EBV genome copy numbers in all four types of HEK293-EBV cells which were either uninduced or induced with TPA and NaB. B(-)Wt, B(-)Mt, B(+)Wt, and B(+)Mt stand for HEK293-EBV cells of BART(-)·S13 + , BART(-)·S13 - , BART(+)·S13 + , BART(+)·S13 - , respectively. Absolute intracellular and extracellular EBV genome copy numbers were Both absolute intracellular and extracellular EBV genome copy numbers were evaluated by EBNA1 Ct values. Relation equation between absolute DNA amounts and EBNA1 Ct values was first defined and then applied to calculate DNA concentration (μg/μL) per length of template (bp) using a website called Copy Number Calculator of Technology NetWorks ( https://www.technologynetworks.com/tn/tools/copynumbercalculator ). Finally, Both absolute intracellular and extracellular EBV genome copy numbers were calculated by relatively comparing EBV genome copy numbers of Mt BART(+/-)·S13 - EBVs with EBV genome copy numbers of Wt BART(+/-)·S13 + EBVs. B) Comparison of expression patterns of the selected five BART miRNAs between uninduced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. C) Comparison of expression patterns of the selected five BART miRNAs between induced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. 3 mM NaB and 20 μg/mL TPA were used to induce EBV lytic reactivation. D) Comparison of transcription patterns of EBV major genes between uninduced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. E) Comparison of transcription patterns of EBV major genes between induced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. F) Comparison of expression patterns of EBNA1 and BZLF1 proteins between BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells in uninduced or induced conditions. In panels, experiments were independently repeated two times, and data are represented as mean ± SD. Statistical analysis were performed using paired t test.
Plasmid Id, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid id/product/Addgene inc
Average 90 stars, based on 1 article reviews
plasmid id - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

92
Addgene inc retroviral plasmid mscv n flag ebna1
A) Relative quantification of relative intracellular and extracellular EBV genome copy numbers. qPCR assay with <t>EBNA1</t> primer set (EBV 96778–96979, EBV 96827–96845) was conducted to measure EBV genome copy numbers in all four types of HEK293-EBV cells which were either uninduced or induced with TPA and NaB. B(-)Wt, B(-)Mt, B(+)Wt, and B(+)Mt stand for HEK293-EBV cells of BART(-)·S13 + , BART(-)·S13 - , BART(+)·S13 + , BART(+)·S13 - , respectively. Absolute intracellular and extracellular EBV genome copy numbers were Both absolute intracellular and extracellular EBV genome copy numbers were evaluated by EBNA1 Ct values. Relation equation between absolute DNA amounts and EBNA1 Ct values was first defined and then applied to calculate DNA concentration (μg/μL) per length of template (bp) using a website called Copy Number Calculator of Technology NetWorks ( https://www.technologynetworks.com/tn/tools/copynumbercalculator ). Finally, Both absolute intracellular and extracellular EBV genome copy numbers were calculated by relatively comparing EBV genome copy numbers of Mt BART(+/-)·S13 - EBVs with EBV genome copy numbers of Wt BART(+/-)·S13 + EBVs. B) Comparison of expression patterns of the selected five BART miRNAs between uninduced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. C) Comparison of expression patterns of the selected five BART miRNAs between induced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. 3 mM NaB and 20 μg/mL TPA were used to induce EBV lytic reactivation. D) Comparison of transcription patterns of EBV major genes between uninduced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. E) Comparison of transcription patterns of EBV major genes between induced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. F) Comparison of expression patterns of EBNA1 and BZLF1 proteins between BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells in uninduced or induced conditions. In panels, experiments were independently repeated two times, and data are represented as mean ± SD. Statistical analysis were performed using paired t test.
Retroviral Plasmid Mscv N Flag Ebna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/retroviral plasmid mscv n flag ebna1/product/Addgene inc
Average 92 stars, based on 1 article reviews
retroviral plasmid mscv n flag ebna1 - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

90
Novus Biologicals antibodies against ebna1
A) Relative quantification of relative intracellular and extracellular EBV genome copy numbers. qPCR assay with <t>EBNA1</t> primer set (EBV 96778–96979, EBV 96827–96845) was conducted to measure EBV genome copy numbers in all four types of HEK293-EBV cells which were either uninduced or induced with TPA and NaB. B(-)Wt, B(-)Mt, B(+)Wt, and B(+)Mt stand for HEK293-EBV cells of BART(-)·S13 + , BART(-)·S13 - , BART(+)·S13 + , BART(+)·S13 - , respectively. Absolute intracellular and extracellular EBV genome copy numbers were Both absolute intracellular and extracellular EBV genome copy numbers were evaluated by EBNA1 Ct values. Relation equation between absolute DNA amounts and EBNA1 Ct values was first defined and then applied to calculate DNA concentration (μg/μL) per length of template (bp) using a website called Copy Number Calculator of Technology NetWorks ( https://www.technologynetworks.com/tn/tools/copynumbercalculator ). Finally, Both absolute intracellular and extracellular EBV genome copy numbers were calculated by relatively comparing EBV genome copy numbers of Mt BART(+/-)·S13 - EBVs with EBV genome copy numbers of Wt BART(+/-)·S13 + EBVs. B) Comparison of expression patterns of the selected five BART miRNAs between uninduced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. C) Comparison of expression patterns of the selected five BART miRNAs between induced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. 3 mM NaB and 20 μg/mL TPA were used to induce EBV lytic reactivation. D) Comparison of transcription patterns of EBV major genes between uninduced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. E) Comparison of transcription patterns of EBV major genes between induced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. F) Comparison of expression patterns of EBNA1 and BZLF1 proteins between BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells in uninduced or induced conditions. In panels, experiments were independently repeated two times, and data are represented as mean ± SD. Statistical analysis were performed using paired t test.
Antibodies Against Ebna1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibodies against ebna1/product/Novus Biologicals
Average 90 stars, based on 1 article reviews
antibodies against ebna1 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

86
Novus Biologicals mabe8 antibody ebna1 antibody 1b5 monoclonal novus biologicals nb
Fig. 1 The PPI mediated by <t>EBNA1</t> and PAX5 in vitro and in vivo. (A) The expression 734
Mabe8 Antibody Ebna1 Antibody 1b5 Monoclonal Novus Biologicals Nb, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mabe8 antibody ebna1 antibody 1b5 monoclonal novus biologicals nb/product/Novus Biologicals
Average 86 stars, based on 1 article reviews
mabe8 antibody ebna1 antibody 1b5 monoclonal novus biologicals nb - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

90
Novus Biologicals ebna 1
Fig. 1 The PPI mediated by <t>EBNA1</t> and PAX5 in vitro and in vivo. (A) The expression 734
Ebna 1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ebna 1/product/Novus Biologicals
Average 90 stars, based on 1 article reviews
ebna 1 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Proteintech α ebp2
Fig. 1 The PPI mediated by <t>EBNA1</t> and PAX5 in vitro and in vivo. (A) The expression 734
α Ebp2, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/α ebp2/product/Proteintech
Average 90 stars, based on 1 article reviews
α ebp2 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

93
Biorbyt ebna1 fluorescein isothiocyanate fitc
Fig. 1 The PPI mediated by <t>EBNA1</t> and PAX5 in vitro and in vivo. (A) The expression 734
Ebna1 Fluorescein Isothiocyanate Fitc, supplied by Biorbyt, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ebna1 fluorescein isothiocyanate fitc/product/Biorbyt
Average 93 stars, based on 1 article reviews
ebna1 fluorescein isothiocyanate fitc - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

92
OriGene ebna1
Fig. 1 The PPI mediated by <t>EBNA1</t> and PAX5 in vitro and in vivo. (A) The expression 734
Ebna1, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ebna1/product/OriGene
Average 92 stars, based on 1 article reviews
ebna1 - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

Image Search Results


T cell responses towards the viral antigens EBNA1 and BZLF1 and the superantigen SEB in cirrhosis. ( A ) Representative plots of intracellular cytokine staining for TNF-α and IFN-γ in T cells after stimulation with SEB. ( B ) Distribution and median of T cell responses after stimulation with SEB, EBNA1 and BZLF1 in controls (circles), cirrhotic patients without inflammation (diamonds) and cirrhotic patients with inflammation (triangles). A positive response was defined as a cytokine-positive cell frequency of at least 2-fold above background (no antigen control) and the responses for TNF-α in CD4 + and CD8 + cells and for IFN-γ in CD4 + and CD8 + cells were added to a total score of 0 to 4. ( C ) Median and distribution of reacting CD4 T cells (left) and CD8 T cells (right) after SEB stimulation in cirrhotic patients with and without inflammation (+/−infl). ** indicates P values <0.01 in Mann–Whitney U test. ( D ) Mean florescence intensity (MFI) and standard error of mean are indicated for the intensity of TNF-α or IFN-γ response in CD4 + and CD8 + T cells after stimulation with SEB. P-values indicate results in Kruskal-Wallis test for each cytokine and T cell subset and asterisks indicate significance level in post-hoc Dunn’s multiple comparison test (* P <0.05; ** p<0.01). ( E ) Serum IL-10 levels from cirrhotic patients with a null response according to the aforementioned criteria (0) and from cirrhotic patients with at least one cytokine response (+) after stimulation with EBNA1 and BZLF1 are indicated (available from 25 cirrhotic patients). Patients were either stratified for the presence of a null response to EBNA1 or BZLF1 (left; P value in Mann–Whitney U test is indicated) and stratified for the combination of null-responses towards EBNA1 and BZLF1 (right; Jonckheere-Terpstra test demonstrates an increase in IL-10 in patients across the groups).

Journal: BMC Gastroenterology

Article Title: Attenuated antigen-specific T cell responses in cirrhosis are accompanied by elevated serum interleukin-10 levels and down-regulation of HLA-DR on monocytes

doi: 10.1186/1471-230X-13-37

Figure Lengend Snippet: T cell responses towards the viral antigens EBNA1 and BZLF1 and the superantigen SEB in cirrhosis. ( A ) Representative plots of intracellular cytokine staining for TNF-α and IFN-γ in T cells after stimulation with SEB. ( B ) Distribution and median of T cell responses after stimulation with SEB, EBNA1 and BZLF1 in controls (circles), cirrhotic patients without inflammation (diamonds) and cirrhotic patients with inflammation (triangles). A positive response was defined as a cytokine-positive cell frequency of at least 2-fold above background (no antigen control) and the responses for TNF-α in CD4 + and CD8 + cells and for IFN-γ in CD4 + and CD8 + cells were added to a total score of 0 to 4. ( C ) Median and distribution of reacting CD4 T cells (left) and CD8 T cells (right) after SEB stimulation in cirrhotic patients with and without inflammation (+/−infl). ** indicates P values <0.01 in Mann–Whitney U test. ( D ) Mean florescence intensity (MFI) and standard error of mean are indicated for the intensity of TNF-α or IFN-γ response in CD4 + and CD8 + T cells after stimulation with SEB. P-values indicate results in Kruskal-Wallis test for each cytokine and T cell subset and asterisks indicate significance level in post-hoc Dunn’s multiple comparison test (* P <0.05; ** p<0.01). ( E ) Serum IL-10 levels from cirrhotic patients with a null response according to the aforementioned criteria (0) and from cirrhotic patients with at least one cytokine response (+) after stimulation with EBNA1 and BZLF1 are indicated (available from 25 cirrhotic patients). Patients were either stratified for the presence of a null response to EBNA1 or BZLF1 (left; P value in Mann–Whitney U test is indicated) and stratified for the combination of null-responses towards EBNA1 and BZLF1 (right; Jonckheere-Terpstra test demonstrates an increase in IL-10 in patients across the groups).

Article Snippet: The peptide pools (15-mers with 11 amino-acid overlaps) for Epstein-Barr nuclear antigen 1 (EBNA1) (130-093-613; Miltenyi Biotec, Bergisch Gladbach, Germany) or BamHI Z fragment leftward open reading frame number 1 (BZLF1) (130-093-611; Miltenyi) were added at a final concentration of 0.6 nM per reaction.

Techniques: Staining, Control, MANN-WHITNEY, Comparison

A) Relative quantification of relative intracellular and extracellular EBV genome copy numbers. qPCR assay with EBNA1 primer set (EBV 96778–96979, EBV 96827–96845) was conducted to measure EBV genome copy numbers in all four types of HEK293-EBV cells which were either uninduced or induced with TPA and NaB. B(-)Wt, B(-)Mt, B(+)Wt, and B(+)Mt stand for HEK293-EBV cells of BART(-)·S13 + , BART(-)·S13 - , BART(+)·S13 + , BART(+)·S13 - , respectively. Absolute intracellular and extracellular EBV genome copy numbers were Both absolute intracellular and extracellular EBV genome copy numbers were evaluated by EBNA1 Ct values. Relation equation between absolute DNA amounts and EBNA1 Ct values was first defined and then applied to calculate DNA concentration (μg/μL) per length of template (bp) using a website called Copy Number Calculator of Technology NetWorks ( https://www.technologynetworks.com/tn/tools/copynumbercalculator ). Finally, Both absolute intracellular and extracellular EBV genome copy numbers were calculated by relatively comparing EBV genome copy numbers of Mt BART(+/-)·S13 - EBVs with EBV genome copy numbers of Wt BART(+/-)·S13 + EBVs. B) Comparison of expression patterns of the selected five BART miRNAs between uninduced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. C) Comparison of expression patterns of the selected five BART miRNAs between induced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. 3 mM NaB and 20 μg/mL TPA were used to induce EBV lytic reactivation. D) Comparison of transcription patterns of EBV major genes between uninduced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. E) Comparison of transcription patterns of EBV major genes between induced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. F) Comparison of expression patterns of EBNA1 and BZLF1 proteins between BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells in uninduced or induced conditions. In panels, experiments were independently repeated two times, and data are represented as mean ± SD. Statistical analysis were performed using paired t test.

Journal: PLOS Pathogens

Article Title: Characterization of a new CCCTC-binding factor binding site as a dual regulator of Epstein-Barr virus latent infection

doi: 10.1371/journal.ppat.1011078

Figure Lengend Snippet: A) Relative quantification of relative intracellular and extracellular EBV genome copy numbers. qPCR assay with EBNA1 primer set (EBV 96778–96979, EBV 96827–96845) was conducted to measure EBV genome copy numbers in all four types of HEK293-EBV cells which were either uninduced or induced with TPA and NaB. B(-)Wt, B(-)Mt, B(+)Wt, and B(+)Mt stand for HEK293-EBV cells of BART(-)·S13 + , BART(-)·S13 - , BART(+)·S13 + , BART(+)·S13 - , respectively. Absolute intracellular and extracellular EBV genome copy numbers were Both absolute intracellular and extracellular EBV genome copy numbers were evaluated by EBNA1 Ct values. Relation equation between absolute DNA amounts and EBNA1 Ct values was first defined and then applied to calculate DNA concentration (μg/μL) per length of template (bp) using a website called Copy Number Calculator of Technology NetWorks ( https://www.technologynetworks.com/tn/tools/copynumbercalculator ). Finally, Both absolute intracellular and extracellular EBV genome copy numbers were calculated by relatively comparing EBV genome copy numbers of Mt BART(+/-)·S13 - EBVs with EBV genome copy numbers of Wt BART(+/-)·S13 + EBVs. B) Comparison of expression patterns of the selected five BART miRNAs between uninduced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. C) Comparison of expression patterns of the selected five BART miRNAs between induced Wt BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. 3 mM NaB and 20 μg/mL TPA were used to induce EBV lytic reactivation. D) Comparison of transcription patterns of EBV major genes between uninduced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. E) Comparison of transcription patterns of EBV major genes between induced BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells. F) Comparison of expression patterns of EBNA1 and BZLF1 proteins between BART(+/-)·S13 + and Mt BART(+/-)·S13 - HEK293-EBV cells in uninduced or induced conditions. In panels, experiments were independently repeated two times, and data are represented as mean ± SD. Statistical analysis were performed using paired t test.

Article Snippet: Cell lysates were loaded onto 8% sodium dodecyl sulfate polyacrylamide electrophoresis gels and subjected to western blot analysis using the following primary antibodies against EBV proteins (1:1000 dilution): anti-EBV EBNA1 (Santa Cruz Biotechnology (SCB), Santa Cruz, CA, USA), anti-EBV BZLF1 (SCB), and anti-beta Actin (SCB).

Techniques: Quantitative Proteomics, Concentration Assay, Comparison, Expressing

Fig. 1 The PPI mediated by EBNA1 and PAX5 in vitro and in vivo. (A) The expression 734

Journal: Journal of Virology

Article Title: B Cell-Specific Transcription Activator PAX5 Recruits p300 To Support EBNA1-Driven Transcription

doi: 10.1128/jvi.02028-19

Figure Lengend Snippet: Fig. 1 The PPI mediated by EBNA1 and PAX5 in vitro and in vivo. (A) The expression 734

Article Snippet: Antibodies and primers used in this study 951 Reagent type or resource Designation Sources or references Identifiers Antibody ANTI-FLAG M2® Monoclonal Antibody Sigma F 3165 Antibody His Antibody Qiagen Cat No/ID:34660 Antibody Anti-EBNA2, clone R3 Monoclonal Antibody Merc Millipore Cat. MABE8 Antibody EBNA1 Antibody (1B5) Monoclonal Novus Biologicals NB 1-04287 Antibody GAPDH Antibody (1D4) Monoclonal Novus Biologicals NB 300-221 Antibody PAX5 (A-11) mouse monoclonal Santa Cruz sc-13146 Antibody EBNA1 (vC-20) Goat polyclonal Santa Cruz sc-17498 Antibody B23 (0412) mouse monoclonal Santa Cruz sc-47725 Antibody C23 (MS-3) mouse monoclonal Santa Cruz sc-8031 Antibody RPL4 (RQ-7) mouse monoclonal Santa Cruz sc-100838 Antibody Actin (I-19) Gout polyclonal Santa Cruz sc-1616 Antibody p300 (F-4) mouse monoclonal Santa Cruz sc-48343 Antibody mAb to Histone H3K4Me2 【Y47】 Abcam ab32356 Antibody Ms mAb to Histone H3K4Me3 Abcam ab12209 Antibody EBNA1-FITC Biobyt orb 4774 Antibody Donkey anti-goat IgG-FITC Santa Cruz sc-2024 Antibody Rhodamine (TRITC) AffiniPure Goat AntiMouse IgG (H+L) Jackson immunoResearch 115-025-062 Antibody Human IgG R & D system MAB002 Primer TR-forward (ChIP assay)(22) Protech TGACACAGACAACCCTGACAA Primer TR-reverse (ChIP assay)(22) Protech CTCCACTTTTTCCAGGAATGC Primer OriP-DS-forward (ChIP assay)(26) Protech ATGTAAATAAAACCGTGACAGCTCAT Primer oriP-DS-reverse (ChIP assay)(26) Protech TTACCCAACGGGAAGCATATG Primer oriP-FR(SC3)-forward (ChIP assay)(29) Protech TCCATTATCCCGCAGTTCCAC Primer oriP-FR(SC3)-reverse (ChIP assay)(29) Protech GCCGAATACCCTTCTCCCAGAG Primer Cp-forward (ChIP assay)(22) Protech ATAACGCCTTATCTGGGAGGA Primer Cp-reverse (ChIP assay)(22) Protech ACCACTTTAGACGTTGCTCCA Primer CD79a-forward (ChIP assay)(22) Protech ACTCACAGCCTGAAGCATACC Primer CD79a-reverse (ChIP assay)(22) Protech AAACCCCACCCTACTTCCTG Primer oriP-forward (genome copy number assay)(27) Protech GCTAAACGAAGGAGAATGAAGAAG Primer oriP-reverse (genome copy number assay)(27) Protech CAGTGGCTGAAGATCAAGGAG Table 1.

Techniques: In Vitro, In Vivo, Expressing

Fig. 2 PAX5 has a critical role in EBNA1/oriP-dependent functions. (A) 10 or 30 μg of 768

Journal: Journal of Virology

Article Title: B Cell-Specific Transcription Activator PAX5 Recruits p300 To Support EBNA1-Driven Transcription

doi: 10.1128/jvi.02028-19

Figure Lengend Snippet: Fig. 2 PAX5 has a critical role in EBNA1/oriP-dependent functions. (A) 10 or 30 μg of 768

Article Snippet: Antibodies and primers used in this study 951 Reagent type or resource Designation Sources or references Identifiers Antibody ANTI-FLAG M2® Monoclonal Antibody Sigma F 3165 Antibody His Antibody Qiagen Cat No/ID:34660 Antibody Anti-EBNA2, clone R3 Monoclonal Antibody Merc Millipore Cat. MABE8 Antibody EBNA1 Antibody (1B5) Monoclonal Novus Biologicals NB 1-04287 Antibody GAPDH Antibody (1D4) Monoclonal Novus Biologicals NB 300-221 Antibody PAX5 (A-11) mouse monoclonal Santa Cruz sc-13146 Antibody EBNA1 (vC-20) Goat polyclonal Santa Cruz sc-17498 Antibody B23 (0412) mouse monoclonal Santa Cruz sc-47725 Antibody C23 (MS-3) mouse monoclonal Santa Cruz sc-8031 Antibody RPL4 (RQ-7) mouse monoclonal Santa Cruz sc-100838 Antibody Actin (I-19) Gout polyclonal Santa Cruz sc-1616 Antibody p300 (F-4) mouse monoclonal Santa Cruz sc-48343 Antibody mAb to Histone H3K4Me2 【Y47】 Abcam ab32356 Antibody Ms mAb to Histone H3K4Me3 Abcam ab12209 Antibody EBNA1-FITC Biobyt orb 4774 Antibody Donkey anti-goat IgG-FITC Santa Cruz sc-2024 Antibody Rhodamine (TRITC) AffiniPure Goat AntiMouse IgG (H+L) Jackson immunoResearch 115-025-062 Antibody Human IgG R & D system MAB002 Primer TR-forward (ChIP assay)(22) Protech TGACACAGACAACCCTGACAA Primer TR-reverse (ChIP assay)(22) Protech CTCCACTTTTTCCAGGAATGC Primer OriP-DS-forward (ChIP assay)(26) Protech ATGTAAATAAAACCGTGACAGCTCAT Primer oriP-DS-reverse (ChIP assay)(26) Protech TTACCCAACGGGAAGCATATG Primer oriP-FR(SC3)-forward (ChIP assay)(29) Protech TCCATTATCCCGCAGTTCCAC Primer oriP-FR(SC3)-reverse (ChIP assay)(29) Protech GCCGAATACCCTTCTCCCAGAG Primer Cp-forward (ChIP assay)(22) Protech ATAACGCCTTATCTGGGAGGA Primer Cp-reverse (ChIP assay)(22) Protech ACCACTTTAGACGTTGCTCCA Primer CD79a-forward (ChIP assay)(22) Protech ACTCACAGCCTGAAGCATACC Primer CD79a-reverse (ChIP assay)(22) Protech AAACCCCACCCTACTTCCTG Primer oriP-forward (genome copy number assay)(27) Protech GCTAAACGAAGGAGAATGAAGAAG Primer oriP-reverse (genome copy number assay)(27) Protech CAGTGGCTGAAGATCAAGGAG Table 1.

Techniques:

Fig. 3 EBNA1 requires PAX5 to associate with either the oriP or TRs -DNA. (A) The 807

Journal: Journal of Virology

Article Title: B Cell-Specific Transcription Activator PAX5 Recruits p300 To Support EBNA1-Driven Transcription

doi: 10.1128/jvi.02028-19

Figure Lengend Snippet: Fig. 3 EBNA1 requires PAX5 to associate with either the oriP or TRs -DNA. (A) The 807

Article Snippet: Antibodies and primers used in this study 951 Reagent type or resource Designation Sources or references Identifiers Antibody ANTI-FLAG M2® Monoclonal Antibody Sigma F 3165 Antibody His Antibody Qiagen Cat No/ID:34660 Antibody Anti-EBNA2, clone R3 Monoclonal Antibody Merc Millipore Cat. MABE8 Antibody EBNA1 Antibody (1B5) Monoclonal Novus Biologicals NB 1-04287 Antibody GAPDH Antibody (1D4) Monoclonal Novus Biologicals NB 300-221 Antibody PAX5 (A-11) mouse monoclonal Santa Cruz sc-13146 Antibody EBNA1 (vC-20) Goat polyclonal Santa Cruz sc-17498 Antibody B23 (0412) mouse monoclonal Santa Cruz sc-47725 Antibody C23 (MS-3) mouse monoclonal Santa Cruz sc-8031 Antibody RPL4 (RQ-7) mouse monoclonal Santa Cruz sc-100838 Antibody Actin (I-19) Gout polyclonal Santa Cruz sc-1616 Antibody p300 (F-4) mouse monoclonal Santa Cruz sc-48343 Antibody mAb to Histone H3K4Me2 【Y47】 Abcam ab32356 Antibody Ms mAb to Histone H3K4Me3 Abcam ab12209 Antibody EBNA1-FITC Biobyt orb 4774 Antibody Donkey anti-goat IgG-FITC Santa Cruz sc-2024 Antibody Rhodamine (TRITC) AffiniPure Goat AntiMouse IgG (H+L) Jackson immunoResearch 115-025-062 Antibody Human IgG R & D system MAB002 Primer TR-forward (ChIP assay)(22) Protech TGACACAGACAACCCTGACAA Primer TR-reverse (ChIP assay)(22) Protech CTCCACTTTTTCCAGGAATGC Primer OriP-DS-forward (ChIP assay)(26) Protech ATGTAAATAAAACCGTGACAGCTCAT Primer oriP-DS-reverse (ChIP assay)(26) Protech TTACCCAACGGGAAGCATATG Primer oriP-FR(SC3)-forward (ChIP assay)(29) Protech TCCATTATCCCGCAGTTCCAC Primer oriP-FR(SC3)-reverse (ChIP assay)(29) Protech GCCGAATACCCTTCTCCCAGAG Primer Cp-forward (ChIP assay)(22) Protech ATAACGCCTTATCTGGGAGGA Primer Cp-reverse (ChIP assay)(22) Protech ACCACTTTAGACGTTGCTCCA Primer CD79a-forward (ChIP assay)(22) Protech ACTCACAGCCTGAAGCATACC Primer CD79a-reverse (ChIP assay)(22) Protech AAACCCCACCCTACTTCCTG Primer oriP-forward (genome copy number assay)(27) Protech GCTAAACGAAGGAGAATGAAGAAG Primer oriP-reverse (genome copy number assay)(27) Protech CAGTGGCTGAAGATCAAGGAG Table 1.

Techniques:

Fig. 4 The PPI induced by EBNA1 and PAX5 is required for EBNA1/oriP-mediated 832

Journal: Journal of Virology

Article Title: B Cell-Specific Transcription Activator PAX5 Recruits p300 To Support EBNA1-Driven Transcription

doi: 10.1128/jvi.02028-19

Figure Lengend Snippet: Fig. 4 The PPI induced by EBNA1 and PAX5 is required for EBNA1/oriP-mediated 832

Article Snippet: Antibodies and primers used in this study 951 Reagent type or resource Designation Sources or references Identifiers Antibody ANTI-FLAG M2® Monoclonal Antibody Sigma F 3165 Antibody His Antibody Qiagen Cat No/ID:34660 Antibody Anti-EBNA2, clone R3 Monoclonal Antibody Merc Millipore Cat. MABE8 Antibody EBNA1 Antibody (1B5) Monoclonal Novus Biologicals NB 1-04287 Antibody GAPDH Antibody (1D4) Monoclonal Novus Biologicals NB 300-221 Antibody PAX5 (A-11) mouse monoclonal Santa Cruz sc-13146 Antibody EBNA1 (vC-20) Goat polyclonal Santa Cruz sc-17498 Antibody B23 (0412) mouse monoclonal Santa Cruz sc-47725 Antibody C23 (MS-3) mouse monoclonal Santa Cruz sc-8031 Antibody RPL4 (RQ-7) mouse monoclonal Santa Cruz sc-100838 Antibody Actin (I-19) Gout polyclonal Santa Cruz sc-1616 Antibody p300 (F-4) mouse monoclonal Santa Cruz sc-48343 Antibody mAb to Histone H3K4Me2 【Y47】 Abcam ab32356 Antibody Ms mAb to Histone H3K4Me3 Abcam ab12209 Antibody EBNA1-FITC Biobyt orb 4774 Antibody Donkey anti-goat IgG-FITC Santa Cruz sc-2024 Antibody Rhodamine (TRITC) AffiniPure Goat AntiMouse IgG (H+L) Jackson immunoResearch 115-025-062 Antibody Human IgG R & D system MAB002 Primer TR-forward (ChIP assay)(22) Protech TGACACAGACAACCCTGACAA Primer TR-reverse (ChIP assay)(22) Protech CTCCACTTTTTCCAGGAATGC Primer OriP-DS-forward (ChIP assay)(26) Protech ATGTAAATAAAACCGTGACAGCTCAT Primer oriP-DS-reverse (ChIP assay)(26) Protech TTACCCAACGGGAAGCATATG Primer oriP-FR(SC3)-forward (ChIP assay)(29) Protech TCCATTATCCCGCAGTTCCAC Primer oriP-FR(SC3)-reverse (ChIP assay)(29) Protech GCCGAATACCCTTCTCCCAGAG Primer Cp-forward (ChIP assay)(22) Protech ATAACGCCTTATCTGGGAGGA Primer Cp-reverse (ChIP assay)(22) Protech ACCACTTTAGACGTTGCTCCA Primer CD79a-forward (ChIP assay)(22) Protech ACTCACAGCCTGAAGCATACC Primer CD79a-reverse (ChIP assay)(22) Protech AAACCCCACCCTACTTCCTG Primer oriP-forward (genome copy number assay)(27) Protech GCTAAACGAAGGAGAATGAAGAAG Primer oriP-reverse (genome copy number assay)(27) Protech CAGTGGCTGAAGATCAAGGAG Table 1.

Techniques:

Fig. 6 PAX5 recruits p300 to support EBNA1/oriP-mediated transcription. (A) The 904

Journal: Journal of Virology

Article Title: B Cell-Specific Transcription Activator PAX5 Recruits p300 To Support EBNA1-Driven Transcription

doi: 10.1128/jvi.02028-19

Figure Lengend Snippet: Fig. 6 PAX5 recruits p300 to support EBNA1/oriP-mediated transcription. (A) The 904

Article Snippet: Antibodies and primers used in this study 951 Reagent type or resource Designation Sources or references Identifiers Antibody ANTI-FLAG M2® Monoclonal Antibody Sigma F 3165 Antibody His Antibody Qiagen Cat No/ID:34660 Antibody Anti-EBNA2, clone R3 Monoclonal Antibody Merc Millipore Cat. MABE8 Antibody EBNA1 Antibody (1B5) Monoclonal Novus Biologicals NB 1-04287 Antibody GAPDH Antibody (1D4) Monoclonal Novus Biologicals NB 300-221 Antibody PAX5 (A-11) mouse monoclonal Santa Cruz sc-13146 Antibody EBNA1 (vC-20) Goat polyclonal Santa Cruz sc-17498 Antibody B23 (0412) mouse monoclonal Santa Cruz sc-47725 Antibody C23 (MS-3) mouse monoclonal Santa Cruz sc-8031 Antibody RPL4 (RQ-7) mouse monoclonal Santa Cruz sc-100838 Antibody Actin (I-19) Gout polyclonal Santa Cruz sc-1616 Antibody p300 (F-4) mouse monoclonal Santa Cruz sc-48343 Antibody mAb to Histone H3K4Me2 【Y47】 Abcam ab32356 Antibody Ms mAb to Histone H3K4Me3 Abcam ab12209 Antibody EBNA1-FITC Biobyt orb 4774 Antibody Donkey anti-goat IgG-FITC Santa Cruz sc-2024 Antibody Rhodamine (TRITC) AffiniPure Goat AntiMouse IgG (H+L) Jackson immunoResearch 115-025-062 Antibody Human IgG R & D system MAB002 Primer TR-forward (ChIP assay)(22) Protech TGACACAGACAACCCTGACAA Primer TR-reverse (ChIP assay)(22) Protech CTCCACTTTTTCCAGGAATGC Primer OriP-DS-forward (ChIP assay)(26) Protech ATGTAAATAAAACCGTGACAGCTCAT Primer oriP-DS-reverse (ChIP assay)(26) Protech TTACCCAACGGGAAGCATATG Primer oriP-FR(SC3)-forward (ChIP assay)(29) Protech TCCATTATCCCGCAGTTCCAC Primer oriP-FR(SC3)-reverse (ChIP assay)(29) Protech GCCGAATACCCTTCTCCCAGAG Primer Cp-forward (ChIP assay)(22) Protech ATAACGCCTTATCTGGGAGGA Primer Cp-reverse (ChIP assay)(22) Protech ACCACTTTAGACGTTGCTCCA Primer CD79a-forward (ChIP assay)(22) Protech ACTCACAGCCTGAAGCATACC Primer CD79a-reverse (ChIP assay)(22) Protech AAACCCCACCCTACTTCCTG Primer oriP-forward (genome copy number assay)(27) Protech GCTAAACGAAGGAGAATGAAGAAG Primer oriP-reverse (genome copy number assay)(27) Protech CAGTGGCTGAAGATCAAGGAG Table 1.

Techniques: